Öffentlichkeitsarbeit

Schüler färben Mäusezellen in unserem Lehrlabor.

Sie sind herzlich eingeladen uns in unseren Laboren zu besuchen. Gerne gestalten wir auch einen informativen Tag für Gruppen wie z.B. Schulklassen. Sprechen Sie uns früh genug an, um Inhalte und den Zeitrahmen abzusprechen. Bitte haben Sie auch Verständnis dafür, dass wir Ihren Besuch wegen des laufenden Lehr- und Forschungsbetriebs früh genug einplanen müssen.

Veranstaltungen

2019

09. Dezember 2019
RAHMEN: Nobelpreisvorlesung

02. November 2019
RAHMEN: KinderUni
UNSER THEMA: Ist Chemie Hexerei?

22. Oktober 2019
RAHMEN: Bürgertagung mit Vorträgen und Podiumsdiskussion
UNSER THEMA: Biodiversität - Was ist das?

12. September 2019
RAHMEN: ZVO-Oberflächentage, Berlin
UNSER THEMA: Synthese eines neuen Gold(I)- Methansulfonsäure-Komplexes und Entwicklung eines Au-Bades für den ENIG Prozess

21. Juni 2019
RAHMEN: Nacht der Wissenschaft

20. Mai 2019
RAHMEN: Praktikum mit Kindern der Kindertagesstätte Auenzwerge aus Mittweida

18. Mai 2019
RAHMEN: KinderUni
UNSER THEMA: Wie läuft das mit dem Wasser?

06.-17. Mai 2019
RAHMEN: Schülerpraktikum
SCHULE: Martin-Luther-Gymnasium Frankenberg/Sa.

06. April 2019
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

28. Februar 2019
SCHULE: BSZ Schneeberg
THEMA: Fibroblastenfärbung
KONTAKT: Herr Herr

25. Februar 2019
RAHMEN: 12. Gothaer Seniorenakademie
UNSER THEMA: Erbschaft – besteht aus mehr als Erbgut und Materiellem

07. Februar 2019
SCHULE: Lessing-Gymnasium Döbeln, 20 Schüler, 2 Lehrer, Stufe 11
THEMA: PV92
KONTAKT: Frau Rentsch

21. Januar 2019
SCHULE: J.-A.-Stöckhardt-Gymnasiums, Chemnitz, 9 Schüler, 1 Lehrerin, Stufe 11
THEMA: PV92
KONTAKT: Frau Fischer

14. Januar 2019
SCHULE: Gymnasium Burgstädt, 7 Schüler, 1 Lehrer, Stufe 11
THEMA: Fibroblastenfärbung
KONTAKT: Herr Schaarschmidt

10. Januar 2019
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

Nach oben

2018

12. Dezember 2018
RAHMEN: 2nd Workshop BioInformatics meets Machine Learning
UNSER THEMA: WYSIWYG could be TGGTACAGCATCTGGTACGGC – or better

10. Dezember 2018
RAHMEN: Nobelpreisvorlesung

27. November 2018
RAHMEN: Tag der Studienorientierung
SCHULE: BSZ für Agrarwirtschaft und Ernährung Altroßthal
KONTAKT: R. Laspe

23. November 2018
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Bakterienidentifikation

15. November 2018
RAHMEN: 12. Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
THEMA: Um-Welt
UNSER THEMA:Sollen wir uns gesund mutieren? Über Gentechnik und Menschen
KONTAKT: Sabine Ederer

02. November 2018
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Luftkeime

21. September 2018
RAHMEN: STROMER Kick-off symposium, UFZ Leipzig
UNSER THEMA: Porphyrin-based catalysts for reduction reactions

13. September 2018
RAHMEN: Lerncamp Grünheide
UNSER THEMA: Kann man Lebewesen bauen?

15. August 2018
RAHMEN: Summer School "Nonlinear Life edition 2", Riga
UNSER THEMA: Nonlinear Life from a biological point of view

14. Juni 2018
SCHULE: Gymnasien Döbeln und Unna, 12 Schüler, 3 Lehrer, Stufe 10
KONTAKT: Frau Griesbach
RAHMEN: Austauschprogramm
UNSER THEMA: PV92

08. Juni 2018
RAHMEN: Nacht der Wissenschaft
UNSER THEMA: Eiscafe Macht der Wissenschaften

07. Juni 2018
SCHULE: Julius-Motteler-Gymnasium, Crimmitschau
RAHMEN: Abend der Naturwissenschaften
UNSER THEMA: Kann Leben fabriziert werden?

29. Mai 2018
SCHULE: Dr. W. André-Gymnasium Chemnitz
UNSER THEMA: Restriktionsverdau

26. Mai 2018
RAHMEN: Absolvententreffen
UNSER THEMA: Plaudern über gestern und heute bei Gegrilltem, Extrahiertem und Fermentiertem

05. Mai 2018
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

02. Mai 2018
RAHMEN: Ringvorlesung
UNSER THEMA: Egoistische Gene, böse Technik, oder was?

10. - 13. April 2018
RAHMEN: Analytica
UNSER THEMA: Synthetische Biologie und Biogas

27. März:
RAHMEN: Antrittsvorlesung
UNSER THEMA: Die Rückkehr des CO2

11. Januar 2018
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

Nach oben

2017

12. Dezember 2017
RAHMEN: Experimentiertag
SCHULE: Gymnasium Burgstädt
UNSER THEMA: PV92

29. November 2017
RAHMEN: Tag der Studienorientierung
SCHULE: BSZ für Agrarwirtschaft und Ernährung Altroßthal
KONTAKT: E. Hutsch
UNSER THEMA: Über Gene und Technologie

26. November 2017
RAHMEN: 11. Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
THEMA: Um-Welt
UNSER THEMA: Umwelt – Dritte Welt – Eine Welt
Warum sollten wir uns für die Umwelt interessieren? In Voraussicht, unseren Nachkommen zuliebe? Um unser Gewissen zu erleichtern? Aus Gründen der  Gerechtigkeit? Weil Mond und Mars noch weit weg sind? Aus Nächstenliebe? Und: ist nicht ohnehin alles gottgegeben? Ausgehend von Luthers Apfelbaum möchte ich biologische und ethische Gedanken kreisen lassen.
KONTAKT: Sabine Ederer

27. Oktober 2017
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Bakterienidentifikation

20. Oktober 2017
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Luftkeime

11. Oktober 2017
RAHMEN: Kolloquium am Kurt-Schwabe Institut Meinsberg
UNSER THEMA: Porphyrin-basierte Katalysatoren für die Sauerstoffreduktion in PEM-Brennstoffzellen

05. Oktober 2017
RAHMEN:SynbioDay – Infotag der Synthetischen Biologie in Düsseldorf
UNSER THEMA: From Computational to Synthetic Biology

12. September 2017
RAHMEN: Experimentiertag
SCHULE: BSZ Gastgewerbe Ernst Lößnitzer, Dresden
UNSER THEMA: Proteinkristallisation

01. September 2017
RAHMEN: Lerncamp Auerbach
UNSER THEMA: “Gene, Genome, Genies"
Welche Informationen können wir unserem Erbgut über den Zustand des Erbgutträgers entlocken? Wir wollen dabei nicht nur über den Nachweis von Krankheiten sprechen, sondern uns auch fragen, was unsere Gene über unsere Intelligenz aussagen.

24. August 2017
RAHMEN: Summer School "Nonlinear Life", Riga
UNSER THEMA: Nonlinear Life from an Biological Point of View

19. August 2017
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

04. Juli 2017
RAHMEN: Sommercamp 2017
UNSER THEMA: Faszination Chemie

09. Juni 2017
RAHMEN: Nacht der Wissenschaft
UNSERE THEMEN: Können künstliche Blätter einen Beitrag zur Lösung unserer Energieprobleme leisten?, Wir müssen reden! Über Züchtung – beim Menschen!

31.Mai 2017
RAHMEN: 18. Nachwuchswissenschaftlerkonferenz
UUNSERE THEMEN: Towards introducing nanopore sequencing to undergraduate ducation in biotechnology and computational biology und Optimization Of The Phototrophic Hydrogen Evolution With Rhodobacter Sphaeroides Strain 2.4.1 By Fermentation Of Apple Juice

30. Mai 2017
SCHULE: Dr. W. André-Gymnasium Chemnitz, 16 Schüler
UNSER THEMA: Restriktionsverdau

16.-18. Mai 2017
RAHMEN: Biotechnica, Hannover

11.-12. Mai 2017
RAHMEN: Vocatium, Chemnitz

08.-12. Mai 2017
SCHULE: Gymnasium Burgstädt
RAHMEN: Schülerpraktikum

07. Mai 2017
RAHMEN: KinderUni
UNSER THEMA: „Woher kommt der Strom aus der Steckdose?“ 

05.-08. Mai 2017
RAHMEN: 150-Jahrfeier der Hochschule Mittweida

27. April 2017
RAHMEN: Girls´Day | Boys´Day
THEMA: Sicherheit in der Gentechnik - Versuch: Restriktionsverdau

26. April 2017
RAHMEN: Schülerpraktikum
SCHULE: Gymnasium Frankenberg
THEMA: Restriktionsverdau

01. April 2017
RAHMEN: Studieninformationstag
UNSER THEMA: Faszination Biotechnologie

23.-26. März 2017
RAHMEN: Buchmesse Leipzig

06.-10. März 2017
RAHMEN: BMBF-Klausurwoche in Münster
Genom-Editierung in der Humanmedizin?
Ethische und rechtliche Probleme der Anwendung am Menschen
UNSER THEMA: Biomedizinische Forschung und Fortschritt im historisch-
ethischen Kontext

23. Februar 2017
SCHULE: BSZ Schneeberg
RAHMEN: Unterstützung des Biotechnologieunterrrichtes
THEMA: Dreifachfluoreszenzfärbung von Mäusefibroblasten

09. Feburar 2017
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Bakterienidentifikation

02. Feburar 2017
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichtes durch praktische Versuche
THEMA: Luftkeime

13. Januar 2017
SCHULE: Wiprecht-Gymnasium Groitzsch
RAHMEN: Berufs- und Studienorientierungswoche
THEMA: Gentechnologie heute und morgen

12. Januar 2017
RAHMEN: Studieninformationstag

Nach oben

2016

09. Dezember 2016
RAHMEN: Experimentiertag
SCHULE: Gymnasium Burgstädt
Unser Thema: Restriktionsverdau

06. Dezember 2016
RAHMEN: Weihnachtsvorlesung
THEMA: Nobelpreisvorlesung

24. November 2016
RAHMEN: Tag der Studien- und Ausildungsorientierung am BSZ für Agrarwirtschaft und Ernährung
KONTAKT: E. Hutsch

24. November 2016
RAHMEN: 10. Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
THEMA: Wer nichts für andere tut, der tut nichts für sich.
UNSER THEMA: Kinderwunsch - Wunschkinder. Wie aus Liebe Reproduktion wird.
KONTAKT: Sabine Ederer

26. Oktober 2016
RAHMEN: Tag der Forschung
UNSER THEMA: Synergetische Forschung zur Analyse und Optimierung biologischer Systeme

05. Oktober 2016
RAHMEN: Bürgerakademie
UNSER THEMA: Neue Gene ohne Technik? Über Dinge, die wir tun und lassen können

20. September 2016
SCHULE: Semper Schulen Media gGmbH, 11 Schüler
UNSER THEMA: PV92

1. September 2016
RAHMEN: Lerncamp im Waldpark Grünhaide
UNSER THEMA: Alle Menschen sind gleich, oder?

20. August 2016
RAHMEN: Studieninformationstag

17.-18. August 2016
RAHMEN: KölnPUB Frechen
UNSER THEMA: Praxispojekt Biotechnologie: Neue Medikamente Dank Bioinformatik

04. Juli 2016
RAHMEN: Experimentiertag
UNSER THEMA: Einblick in die DNA

23. Juni 2016
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: PV92

07. Juni 2016
SCHULE: Dr. W. André-Gymnasium Chemnitz, 20 Schüler
UNSER THEMA: Restriktionsverdau

03. Juni 2016
RAHMEN: Nacht der Wissenschaft

19. Mai 2016
SCHULE: Gymnasien Döbeln und Unna, 12 Schüler, 4 Lehrer
KONTAKT: Frau Griesbach
RAHMEN: Austauschprogramm
UNSER THEMA: PV92

30. April 2016
RAHMEN: Studieninformationstag

27. April 2016
RAHMEN: Ringvorlesung
UNSER THEMA: Ringvorlesung: "Kinder nach Maß - neue Möglichkeiten der Fortpflanzungsmedizin"

20. April 2016
RAHMEN: 17. Nachwuchswissenschaftlerkonferenz an der HS Schmalkalden
UNSERE THEMEN: Cell-Free Protein Production – The Development Of An In Vitro Expression System For (Cyano)Bacteria (PDF), Transcriptome Analysis Of Hydrogen Producing Rhodobacter Sphaeroides 2.4.1

04. April 2016
RAHMEN: Eröffnung des Schülerlabors der Hochschule Mittweida

29. Februar 2016
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

22. Februar 2016
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

15. Februar 2016
Grüne Gentechnik: Teufelswerk oder ethisches Gebot
Eine Podiumsdiskussion mit Prof. R. Szibor, Prof. M. Wähner, Prof. R. Wünschiers und Frau S. Höhne (Ev. Akademie Wittenberg)
Veranstalter: Kreisvolkshochschule Harz und die Ev. Kirchengemeinde Quedlinburg

15.-19. Februar 2016
SCHULE: Gymnasium Mittweida
RAHMEN: Schülerpraktikum

08.-09. Februar 2016
SCHULE: BSZ Gastgewerbe Dresden
RAHMEN: Unterstützung des Biotechnologieunterrrichtes
UNSER THEMA: Zellfreie Proteinsynthese

03. Februar 2016
SCHULE: BSZ Schneeberg
RAHMEN: Unterstützung des Biotechnologieunterrrichtes
THEMA: PV92

25. Januar - 05. Februar 2016
SCHULE: Johannes-Kepler-Gymnasium
RAHMEN: Schülerpraktikum

14. Januar 2016
RAHMEN: Studieninformationstag
UNSER THEMA: Biotechnologie - Eine Ingenieurwissenschaft mit vielen Facetten

Nach oben

2015

10. Dezember 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

03. Dezember 2015
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
KONTAKT: Sabine Ederer
THEMA: Es gibt immer eine Alternative (PDF)
UNSER THEMA: Proteine produzieren ohne Lebewesen. Nativ? Naiv? Alternativ?

26. November 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

26. November 2015
RAHMEN: Tag der Studien- und Ausildungsorientierung am BSZ für Agrarwirtschaft und Ernährung
KONTAKT: E. Hutsch

19.-20. November 2015
RAHMEN: 24. Internationale Wissenschaftliche Konferenz Mittweida
UNSERE THEMEN: Entwicklung einer Plattform für Integration, Visualisierung und Modellierung von Biodaten, Untersuchung der Dynamik der biologischen Prozesse in Biogasanlagen, Proteinproduktion ohne Lebewesen – Entwicklung eines in vitro Expressionssystems für (Cyano)Bakterien, Analyse der Photo-Wasserstoffproduktion eines neuartigen Rhodobacter Stamms, Forensische Mikrobiologie: Effiziente Klassifikation von Hasenpesterregern

11.-12. November 2015
RAHMEN: 6. Statuskonferenz - Energetische Biomassenutzung
THEMA: Bioenergie - Mehr als eine sichere Reserve?!
UNSER THEMA: Omic-basiertes Monitoring des Wasserstoffentstehungsprozesses mit Rhodobacter sphaeroides

12. November 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

29. Oktober 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

26. September 2015
RAHMEN: KinderUni
UNSER THEMA: „Warum werden die Blätter im Herbst bunt?“

24. - 25. September 2015
RAHMEN: 5. LernCamp
Gymnasialen Netzwerk individuelle Förderung besonders begabter Schülerinnen und Schüler (GIFted)
SCHULE: Goethe-Gymnasium Auerbach und Gymnasium Markneukirchen
UNSER THEMA: Computer gegen Viren

24. September 2015
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

17. September 2015
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

29. August 2015
RAHMEN: Studieninformationstag

07. Juli 2015
SCHULE:  Berufliches Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
RAHMEN: Unterstützung des Biotechnologieunterrrichtes

07. Juli 2015
RAHMEN: Mein Prof. vor Ort

05. Juni 2015
RAHMEN: Nacht der Wissenschaft

27. April - 05. Mai 2015
SCHULE: Georgius-Agricola Gymnasium
RAHMEN: Schülerpraktikum

18. April 2015
RAHMEN: Studieninformationstag   
UNSER THEMA: Biotechnologie im Licht von Ebola und anderen Pandemien

16. April 2015
RAHMEN: 16. Nachwuchswissenschaftlerkonferenz an der HTW Berlin
UNSERE THEMEN: CyanoFactory Knowledge Base – A web-based tool for analysation and visualisation of experimental data, Re-Sequencing Rhodobacter sphaeroides strain 2.4.1 to facilitate understanding varying hydrogen evolution rates, Protein Interaction Network Analysis and Visualization of Synechocystis sp. PCC 6803

17. März 2015
SCHULE: Kepler-Gymnasium Chemnitz
RAHMEN: Berufsinformationstag
UNSER THEMA: Über das Lesen und Schreiben von Erbinformation
KONTAKT: Frau Gottwald

03. März 2015
RAHMEN: Netzwerktagung biotechnologischer Gymnasien

27. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

26. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

21.-22. Januar 2015
SCHULE: BSZ Schneeberg
RAHMEN: Unterstützung des Biotechnologieunterrrichtes
THEMA: PV92

20. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

19. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

15. Januar 2015
RAHMEN: Studieninformationstag   
UNSER THEMA: Biotechnologie im Licht von Ebola und anderen Pandemien

12. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

05. Januar 2015
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

Nach oben

2014

03. Dezember 2014
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
KONTAKT: Sabine Ederer
THEMA: grenzen-los
UNSER THEMA: Was ist an den Grenzen los? Lebenserzeugnung im Labor - zwischen Leben und Tod?

02. Dezmber 2014
RAHMEN: Workshopangebot Schülerforschungszentrum Sachsen e.V.
UNSER THEMA: Moderne Bio- und Gentechnologie
SCHULE: Gymnasium Döbeln, 3 SchülerInnen

29. November 2014
RAHMEN: Workshopangebot Schülerforschungszentrum Sachsen e.V.
UNSER THEMA: Moderne Bio- und Gentechnologie
SCHULE: Gymnasien Raum Freiberg, 12 SchülerInnen

25. November 2014
RAHMEN: Tag der Studien- und Ausildungsorientierung am BSZ für Agrarwirtschaft und Ernährung
KONTAKT: E. Hutsch

14. November 2014
RAHMEN: Studieninforeise

26.-30. Oktober 2014
RAHMEN: BiogasScience 2014

26. - 29. Oktober 2014
SCHULE: BSZ Schneeberg, 2 Schülerinnen
RAHMEN: Schülerpraktikum 

26.-29. Oktober 2014
RAHMEN: GETGEOWEB

05.-08. Oktober 2014
RAHMEN: - Microbiology and Infection 2014 -
4. Gemeinsamer Kongress der Deutschen Gesellschaft für Hygiene und Mikrobiologie (DGHM) e. V. zusammen mit der Vereinigung für Allgemeine und Angewandte Mikrobiologie (VAAM) e. V.
UNSERE THEMEN: A Web-Based Knowledge, Modelling & Visualization Base, Analyzing the metatranscriptome of an anaerobic digestion plant,
Transcriptomic Monitoring of Escherichia coli Growth

19. September 2014
RAHMEN: Synthetische Biologie – Konzepte, Werte, Politik

15.-18. September 2014
RAHMEN: Horizons in Molecular Biology
UNSERE THEMEN: CyanoFactory Knowledge WebBase – A Modelling & Visualization Tool, Transcriptomic Monitoring of Escherichia coli Growth, Efficiency of RNA extraction from selected bacteria in the context of biogas production and metatranscriptomics

23. August 2014
RAHMEN: Studieninformationstag 

13. Juni 2014
RAHMEN: Nacht der Wissenschaft

10.-12. Juni 2014
RAHMEN: 2nd International Conference on Biogas Microbiology ICBM, Uppsala 
UNSER THEMA: Insight and pitfalls in metatranscriptomics

05. Juni 2014
RAHMEN: Plant Science Student Conference, IPK Gatersleben
UNSER THEMA: From light to fuel: Omics research in the field of biomass fermentation and photosynthesis. 

22. Mai 2014
SCHULE: Gymnasien Döbeln und Unna, 12 Schüler, 3 Lehrer, Stufe 10
KONTAKT: Frau Griesbach
RAHMEN: Austauschprogramm
UNSER THEMA: PV92

07. Mai 2014
RAHMEN: Ringvorlesung
UNSER THEMA: Vom Spickzettel zur implantierten Speichererweiterung - Über die Modernisierung des Menschen

12. April 2014
RAHMEN: Studieninformationstag   
UNSER THEMA: Biotechnologie - Eine Ingenieurwissenschaft mit vielen Facetten

01. - 04. April 2014
RAHMEN: Analytica
UNSER THEMA: Synthetische Biologie und Biogas

19. März 2014
RAHMEN: Sächsisches Biotechnologie Symposium
UNSERE THEMEN: Basic research for a better monitoring in anaerobic digestion, CyanoFactory: An Emerging Technology for Solar Fuel
The Knowledge Base

17.-18. Februar 2014
SCHULE: Gymnasium Burgstädt und Rochlitz
RAHMEN: Projekt Brücke
UNSER THEMA: „Biolomatische Infosik

10. Februar 2014
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

03. Februar 2014
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

03. - 14. Februar 2014
SCHULE: Gymnasium Frankenberg, 1 Schülerin
RAHMEN: Schülerpraktikum 

16. Januar 2014
RAHMEN: Studieninformationstag im Bereich Biotechnologie 
SCHULE: Johann-Gottfried-Herder-Gymnasium Schneeberg

09. Januar 2014
RAHMEN: Studieninformationstag   
UNSER THEMA: Biotechnologie - Eine Ingenieurwissenschaft mit vielen Facetten

Nach oben

2013

27. November 2013
RAHMEN: Tag der Studien- und Ausildungsorientierung am BSZ für Agrarwirtschaft und Ernährung
KONTAKT: E. Hutsch

26. November 2013
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer" [Programm]
KONTAKT: Sabine Ederer
UNSER THEMA: Nach der Krise ist vor der Katastrophe, oder? Krisenmanagement biologischer Systeme.

07. November 2013
RAHMEN: 1. Gemeinsame wissenschaftliche Konferenz der sächsischen Hochschulen für Angewandte Wissenschaften
UNSER THEMA: Zeitreihenanalyse der Genexpression bei Escherichia coli zur Validierung von RNA-­Seq Daten

30. Oktober 2013
SCHULE: Raum Zwickau
RAHMEN: Übergangsmanagement Schule-Beruf/Studium
UNSER THEMA: PV92 [Artikel]

21. - 25. Oktober 2013
SCHULE: Gymnasium Burgstädt, 1 Schüler
RAHMEN: Schülerpraktikum 

14. Oktober 2013
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

08. - 10. Oktober 2013
RAHMEN: Biotechnica
UNSER THEMA: Synthetische Biologie und Biogas

07. Oktober 2013
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

30. September 2013
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

23. September 2013
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

18.-22. August 2013
RAHMEN: Interdisziplinäre Expertentagung im Rahmen des Übereinkommens über die biologische Vielfalt
UNSER THEMA: Phylogeographische und ökologische Untersuchungen am Scheidenblütengras (Coleanthus subtilis)

12.-15. Juni 2013
RAHMEN: 8th International Symposium on Anaerobic Microbiology (ISAM8)
UNSER THEMA: The efficiency of isolating RNA from various bacteria using different methods

07. Juni 2013
RAHMEN: Nacht der Wissenschaften

22. Mai 2013
RAHMEN: Bürgerakademie
UNSER THEMA: Bionik - Technische Problemlösungen aus der Natur

07. Mai 2013
RAHMEN: International Day
THEMA: „Abenteuer Ausland – Deine Chance“ Nutzen von Auslandsaufenthalten für die Karriere

20. April 2013
RAHMEN: Studieninformationstag

06. März 2013
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

27. Februar 2013
SCHULE: Gymnasium Oschatz
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

01. Februar 2013
RAHMEN: Gastvortrag
KONTAKT: Prof. Dr. Peter Lindblad
SEIN THEMA: Solar biofuel production using novel cell factories

15. Januar 2013
RAHMEN: Gastvortrag
KONTAKT: Herr Prof. Rheinhard Renneberg
SEIN THEMA: Analytical Biotech: From basics to manufacturing of the fastest heart attack test in the world.

10. Januar 2013
RAHMEN: Tag der offenen Tür
UNSER THEMA: Berufsfeld Biotechnologie: Gene, Genome und Geld

Nach oben

2012

29. November 2012
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

27. November 2012
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
KONTAKT: Sabine Ederer
UNSER THEMA: Biogas

20. November 2012
RAHMEN: Tag der Studien- und Ausildungsorientierung am BSZ für Agrarwirtschaft und Ernährung
KONTAKT: E. Hutsch

15. November 2012
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

24. Oktober 2012
RAHMEN: Gastvortrag innerhalb der 22. Internationalen Wissenschaftlichen Konferenz Mittweida
KONTAKT: Frau PhD Ester Segal
IHR THEMA: Porous Silicon-Based Multiphase and Multiscale Hybrids

18. Oktober 2012
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

11. Oktober 2012
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

26. September 2012
RAHMEN: Ringvorlesung [Kurzfassung]
UNSER THEMA: Betreiben Forscher das Gotteshandwerk? Über die Erzeugung von Leben im Labor.

27. Juli 2012
SCHULE: 4.-9. Klasse
KONTAKT: Frau Susann Pilath
RAHMEN: Experimentiertag
UNSER THEMA: Blähende Saurier und Kavier

03. Juli 2012
RAHMEN: Wissenschaft und Wirtschaft im Dialog
UNSER THEMA: Analyse des Metatranskriptoms in Biogasanlagen

03. Juli 2012
RAHMEN: Abschlussworkshop der Nachwuchsforschergruppe LAMIS
UNSER THEMA: Zeitabhängige Adhäsionseffekte von Zellen auf ta-C-beschichteten und mikrostrukturierten Oberflächen

02. - 13. Juli 2012
SCHULE: Fichteschule Mittweida, 1 Schüler
RAHMEN: Schülerpraktikum 

08. Juni 2012
RAHMEN: Nacht der Wissenschaften
THEMA: "Wissenschaft in Bewegung"
UNSER VORTRAGSTHEMA: "Gentechnik - Was ist das eigentlich?"

24. Mai 2012
SCHULE: Gymnasien Döbeln und Unna, 14 Schüler, 4 Lehrer
KONTAKT: Frau Griesbach
RAHMEN: Austauschprogramm
UNSER THEMA: PV92

20. - 24. Mai 2012
RAHMEN: New Diamond and Nano Carbons Conference - NDNC 2012
UNSER THEMA: Time Correlated Cell-Adhesion Effects on Diamond-Like Carbon Surfaces

10. - 16. Mai 2012
SCHULE: Gymnasium Mittweida, 1 Schüler
RAHMEN: Schülerpraktikum der Klasse 9 

03. Mai 2012
RAHMEN: Forscher entdecken

21. April 2012
RAHMEN: Tag der offenen Tür [Programm]

19. April 2012
RAHMEN: 13. Nachwuchswissenschaftlerkonferenz an der Hochschule Zittau/Görlitz in Görlitz
UNSER THEMA: Determination of the equilibration concentrations of substances during recirculation of process water in anaerobic digestion plants

03. April 2012
SCHULE: Lessing Gymnasium Hohenstein-Ernstthal
RAHMEN: Studienorientierungsprojekt MINT / Schülerpraktikum der Klasse 10
UNSER THEMA: Restriktionsverdau - Schneiden von DNA

23. Februar 2012 [Bild] [Bild]
SCHULE: Berufliches Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer"
RAHMEN: Schülerpraktikum der Klasse 13
UNSER THEMA: Einblicke in die Zellkultur von Mäusefibroblasten

12. Januar 2012
RAHMEN: Tag der offenen Tür [Link]
THEMA: HS Mittweida - die größte WG Deutschlands

Nach oben

2011

26. November 2011 [Flyer] [Bilder zur Vorlesung]
RAHMEN: KinderUni
UNSER THEMA: „Woher kommt der Strom aus der Steckdose?“ 

24. November 2011 [Bild]
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer" (Standbetreuung und Vortrag)
KONTAKT: Kristina Seltmann
UNSER THEMA: Stress schlägt nicht nur auf's Gemüt sondern auch auf's Genom

17. November 2011
SCHULE: Gymnasium Döbeln
RAHMEN: Projekt Brücke
UNSER THEMA: Biotechnologie morgen

14. November 2011
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation

07. November 2011
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

08. Oktober 2011
RAHMEN: Tag der offenen Tür

26. September - 6. Oktober 2011
SCHULE: Freie Waldorfschule Marburg, 1 Schülerin
RAHMEN: Schülerpraktikum der Klasse 8

04. - 08. September 2011
RAHMEN: Conference of the European Society for Biomaterials (ESB) 
UNSER THEMA: Time-Correlated Adhesion Effects of Osteoblastic Cells upon Micro-Structured and ta-C Coated Surfaces

10. Juni 2011
RAHMEN: Nacht der Wissenschaft
THEMA: "Wissenschaft trifft Kunst" [Artikel]

16. - 27. Mai 2011
SCHULE: Gymnasium Mittweida, 1 Schülerin
RAHMEN: Schülerpraktikum der Klasse 9

1. Mai - 17. Juli 2011
RAHMEN: Campus Test - Studieren in Fernost
Thema: BEWEGUNG, GESUNDHEIT UND MEDIZIN: "Warum bist du, was dein Opa aß?"

16. April 2011
RAHMEN: Tag der offenen Tür

14. April 2011
RAHMEN: Girlsday und Boysday
THEMA: Sicherheit in der Gentechnik - Versuch: Restriktionsverdau

23. März 2011
RAHMEN: Bürgerakademie
UNSER THEMA: Wir sind, was wir aßen

02. Februar 2011
RAHMEN: MINT-Individual
KONTAKT: Jana Hoehnisch
UNSER THEMA: Biotechnologie heute

13. Januar 2011
RAHMEN: Tag der offenen Tür [Programm]
UNSER THEMA: "Biotechnologie - Quo vadis?"

Nach oben

2010

30. November 2010
RAHMEN: Tag der Wissenschaften im Beruflichen Schulzentrum für Gastgewerbe Dresden "Ernst Lößnitzer" (Standbetreuung und Vortrag)
KONTAKT: Sabine Ederer
UNSER THEMA: "Ernährung-Evolution-Biotechnologie"

03.-04. November 2010 [Pressemitteilung]
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Bakterienidentifikation und Verdünnungsreihe

27.-28. Oktober 2010
SCHULE: Gymnasium Mittweida
RAHMEN: Unterstützung des Biotechnologie/Bionik-Unterrichts durch praktische Versuche
THEMA: Luftkeime

24. Oktober 2010
RAHMEN: Tag der offenen Tür 

05. Juni 2010 [Flyer] [Vorlesung] [Bilder zur Vorlesung]
RAHMEN: KinderUni
UNSER THEMA: „Stammt der Mensch vom Affen ab?“

04. Juni 2010
RAHMEN: Nacht der Wissenschaft
UNSER THEMA: „Biotechnologie beleuchtet“

8. Mai 2010
Agentur für Arbeit in Plauen
RAHMEN: Hochschultag 2010 (Standbetreuung und Vortrag)

7. Mai 2010
SCHULE: Gymnasien Döbeln und Unna, 16 Schüler, 4 Lehrer, Stufe 11
KONTAKT: Frau Griesbach
RAHMEN: Austauschprogramm
UNSER THEMA: PV92

6. Mai 2010
SCHULE: Gymnasium Burgstädt, 20 Schüler, 1 Lehrer, Stufe 9
KONTAKT: Herr Benedix,
RAHMEN: Tag der Wissenschaften an der Schule
UNSER THEMA: "Der DNA auf der Spur" -> Chromosomenextraktion

22. April 2010
RAHMEN: Girlsday
SCHULE: Dessau, Raum Leipzig sowie Umkreis von Mittweida
UNSER THEMA: Dünnschichtchromatographie von Chlorophyll aus Blättern

19.-30. April 2010
SCHULE: Gymnasium Mittweida, 1 Schülerin
RAHMEN: Schülerpraktikum der Klasse 9

17. April 2010
RAHMEN: Tag der offenen Tür

08.-09. Februar 2010
SCHULE: Gymnasium Mittweida, Burgstädt, Rochlitz, Frankenberg, Penig, Hartha, 12 SchülerInnen
RAHMEN: Projekt Brücke
UNSER THEMA: „Genetischer Fingerabdruck“

02. Februar 2010
RAHMEN: Tag der Wissenschaften in Dresden
KONTAKT: Kristina Seltmann