Prof. Dr. rer. nat. habil Röbbe Wünschiers

Biochemie/Molekularbiologie

Foto von Röbbe Wünschiers
Prof. Dr. rer. nat. habil.
Röbbe Wünschiers
+49 (0)3727 58-1120
+49 (0)3727 58-21120
roebbe.wuenschiers@hs-mittweida.de

Raum 29-15C
Lutherstraße 1a
09648 Mittweida


Pinnwand:
Sprechzeiten nach Vereinbarung

Nach oben

Lehrgebiete

  • Biochemie
  • Genetik/Molekularbiologie
  • Computational Biology
  • Biotechnologie II
  • Molekulare Zellbiologie
  • Methoden der molekularen Diagnostik
  • wissenschaftliches Schreiben
  • Bioethik
  • Gentechnik
  • synthetische Biologie
  • Biolinux

Forschung

  • Molekulare Netzwerke bei der Biogaserzeugung
  • Datenprozessierung und -visualisierung im Kontext der systemischen und synthetischen Biologie

Nach oben

Publikationen

Books

Wünschiers (2019)
Generation Gen-Schere – Wie begegnen wir der gentechnologischen Revolution?
SpringerSpektrum Heidelberg, ISBN 978-3-658-25126-0
[SpringerSpektrum] [accompanying website]

Wünschiers (2019)
Gentechnik – Gene lesen, schreiben und editieren
SpringerSpektrum Heidelberg, ISBN 978-3-658-25126-0
[SpringerSpektrum] [accompanying website]

Wünschiers (2016)
Wiley-Schnellkurs Bioinformatik Datenmassen richtig fassen
Wiley-VCH Weinheim, ISBN 978-3-527-53040-3
[Wiley] [accompanying website]

Wünschiers (2013)
Computational Biology: A Practical Introduction to BioData Processing & Analysis with Linux, MySQL, and R
Springer Publishing Group, ISBN 978-3-642-34748-1
[Springer] [SpringerLink] [accompanying website] [Author Interview]

Wünschiers (2004)
Computational Biology: Unix/Linux, Data Processing and Programming
Springer Publishing Group, ISBN 3-540-21142-X
[SpringerLink] [accompanying website]

Wünschiers (1999)
Eigenschaften, Regulation und Funktion einer Hydrogenase im Wasserstoffmetabolismus der einzelligen Grünalge Scenedesmus obliquus
Görich & Weiershäuser Verlag Marburg, ISBN 3-89703-286-4, Dissertation [PDF]

Nach oben

Book Chapters

Wünschiers (2017) Über die Modernisierung des Menschen. In: Busse & Beer (Eds.) Modernes Leben -- Leben in der Moderne; pp. 123-145; ISBN: 978-3-658-13751-9; VS Verlag für Sozialwissenschaften, Wiesbaden

Wünschiers (2016) Making-of Synthetic Biology: The European CyanoFactory Research Consortium. In: Hagen, Engelhard & Toepfer (Eds.) Ambivalences of Creating Life -- Societal and Philosophical Dimensions of Synthetic Biology; pp. 55-72; ISBN: 978-3-319-21087-2; Springer-Verlag, Berlin, Heidelberg

Wünschiers (2012) Chapter 3.1: Carbohydrate Metabolism and Citrate Cycle. pp. 37-58
Wünschiers (2012) Chapter 3.2: Amino Acids and Derivatives. pp. 58-82
Wünschiers (2012) Chapter 3.4: Lipids and Glycolipids. pp. 93-106
Wünschiers (2012) Chapter 3.5: Steroids and Isoprenoids. pp. 107-123
Wünschiers (2012) Chapter 3.6: Nucleotides and Nucleosides. pp. 124-133
Wünschiers (2012) Chapter 4.2: Protein Biosynthesis in Eukarya.pp. 219-232
Wünschiers (2012) Chapter 4.4: Posttranslational Modification of Proteins. pp. 238-244
In: Michal & Schomburg (Eds); Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology; 2nd Edition; ISBN 978-0-470-14684-2; John Wiley & Sons

Fenner & Wünschiers (2011) Von den Gebeinen Lucys zum Genom des Neandertalers. In: Dreesmann, Graf & Witte (Eds.) Evolutionsbiologie – Moderne Themen für den Unterricht; pp. 405-459; ISBN: 978-3-8274-2785-4; Spektrum Akademischer Verlag, Heidelberg [accompanying website]

Wünschiers (2003) Photobiological Hydrogen Metabolism and Hydrogenases from Green Algae. pp. 353-382
Wünschiers & Lindblad (2003) Light-Dependent Hydrogen Metabolism and Generation by Cyanobacteria. pp. 295-328
In: Nalwa (Ed); Handbook of Photochemistry and Photobiology; Vol. 4;ISBN 1-58883-004-7; American Scientific Publishers; North Lewis Way; CA/USA

Wünschiers, Senger & Schulz (1998) Photohydrogen Production - Hydrogenases In The Green Alga Scenedesmus obliquus.
In: Photosynthesis: Mechanisms and Effects. Ed.: G. Garab; Kluwer Acad. Publ.; Dordrecht/The Netherlands; Vol. III; pp. 1951-1954

Schulz, Schnackenberg, Stangier, Wünschiers, Zinn & Senger (1998) Light dependent hydrogen production of the green alga Scenedesmus obliquus.
In: BioHydrogen. Ed.: O.R. Zarborsky; Plenum Press; New York; pp. 243-251

Wünschiers, Appel, Stangier, Phunpruch & Schulz (1996) Investigations to Apply Biologically Produced Photohydrogen as a Future Energy Source.
In: Biomass for Energy and the Environment. Ed.: P. Chartier, G.J. Ferrero, U.M. Henius, S. Hultberg, J. Sachau, M. Wiinblad; 1. Edition; Elsevier Science Ltd.; Oxford/New York/Tokyo; pp. 1668-1673

Nach oben

Research & Education

2019

CyanoFactory, a European consortium to develop technologies needed to advance cyanobacteria as chassis for production of chemicals and fuels
Lindblad P, Fuente D, Borbe F, Cicchi B, Conejero JA, Couto N, Celesnik H, Diano M, Dolinar M, Esposito S, Evans C, Ferreira E, Keller J, Khanna N, Kind G, Landels A, Lemus L, Noirel J, Ocklenburg S, Oliveira P, Pacheco C, Parker J, Pereira J, Pham K, Pinto F, Rexroth S, Rögner M, Schmitz H-J, Silva Benavides AM, Siurana M, Tamagnini P, Touloupakis E, Torzillo G, Urchueguia J, Wegelius A, Wiegand K, Wright W, Wutschel M & Wünschiers R (in press) Algal Research DOI

2018

SDS-PAGE fractionation to increase metaproteomic insight into taxonomic and functional composition of microbial communities for biogas plant samples
Wenzel L, Heyer R, Schallert K, Löser L, Wünschiers R, Reichl U & Benndorf D (accepted) Engineering in Life Sciences

Analyse Biologischer Systeme: Von Datenmassen zum Modell
Wünschiers R
GIT Laborfachteitschrift 62(3):41-43 [GIT Labor-Fachzeitschrift] [PDF]

A single σ54 transcription factor L420P mutation contributes to increased nitrogen tolerance of photofermentative hydrogen production in Rhodobacter sphaeroides strain 2.4.1
Wappler N & Wünschiers R (submitted)

2016

Genomic Characterization of a Continuous Hydrogen Producing Substrain of Rhodobacter spheroids
Wappler N, Helbig K, Weber J & Wünschiers R (submitted)

Über die Modernisierung des Menschen
R. Wünschiers (in production, 2016)
In: Busse S & Beer K, Modernes Leben - Leben in der Moderne. Springer VS-Verlag

Making-of Synthetic Biology:
 The European CyanoFactory Research Consortium
R. Wünschiers (2016)
In: Hagen K, Engelhard M & Toepfer G, Ambivalences of Creating Life. Societal and Philosophical Dimensions of Synthetic Biology. pp. 55-72; ISBN: 978-3-319-21087-2; Springer-Verlag, Berlin, Heidelberg

2015

Re-Sequencing Rhodobacter sphaeroides strain 2.4.1 to facilitate understanding of varying hydrogen evolution rates
N. Wappler, E. Zuchantke & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 262-267). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

Protein Interaction Network Analysis and Visualization of Synechocystis sp. PCC 6803
E. Zuchantke, G. Kind & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 257-261). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

CyanoFactory Knowledge Base -- A web-based tool for analysis and visualization of experimental data
G. Kind, E. Zuchantke & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 187-191). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

CyanoFactory Knowledge Base & Synthetic Biology: A Plea for Human Curated Bio-databases
G. Kind, E. Zuchantke & R. Wünschiers
In: O. Pastor, C. Sinoquet, A. Fred, H. Gamboa, & D. Elias, 6th International Conference on Bioinformatics Models, Methods and Algorithms (pp. 237–242). Lisboa/Portugal, ISBN 978-989-758-070-3

2014

Efficiency of RNA extraction from selected bacteria in the context of biogas production and metatranscriptomics
L. Stark, T. Giersch & R. Wünschiers
Anaerobe 29:85-90 [PDF]

2012

A Clustering Approach to Detect mRNA-Degradation Patterns from DNA-Microarray Gene-Expression Data
S. Motameny & R. Wünschiers
Biosystems & Information Technology 1:6-13 [PDF]

Nutrilyzer: A Tool for Deciphering Atomic Stoichiometry of Differentially Expressed Paralogous Proteins.
K. Lotz, F. Schreiber & R. Wünschiers
J. Integr. Bioinf. 9:196 [PDF]

Determination of the equilibration concentrations of substances during recirculation of process water in anaerobic digestion plants.
L. Stark, T. Keil, C. Herbes & R. Wünschiers
In: Honekamp & Schindler (Eds); 13. Nachwuchswissenschaftlerkonferenz mitteldeutscher Fachhochschulen; ISBN 978-3-86870-436-5; pp 293-298

Synthetische Biologie – Nichts Neues? Plädoyer für eine Auseinandersetzung im Unterricht
R. Wünschiers
Praxis der Naturwissenschaften 61:23-34

Bioinformatik und Synthetische Biologie - Oder: Wie modern soll moderner Biologieunterricht sein?
D. Dreesmann & R. Wünschiers
Praxis der Naturwissenschaften 61:4-5

MAVisto: A Tool for Biological Network Motif Analysis
H. Schwöbbermeyer & R. Wünschiers
Methods in Molecular Biology 804:263-280
Example Network Files: [GML] | [NET]

2011

Biotechnologie - Endlich eine Ingenieurwissenschaft?
R. Wünschiers
Hochschulblatt Mittweida 34:41-42 [PDF]

2010

The LAILAPS Search Engine: Relevance Ranking in Life Science Databases
M. Lange, K. Spies, J. Bargsten, G. Haberhauer, M. Klapperstück, M. Leps, C. Weinel, R. Wünschiers, M. Weissbach, J. Stein and Uwe Scholz
J. Integr. Bioinf. 7:110, [download]

2009

Mehrskalen-Stoffwechselmodelle von Getreiden: Ein integrativer systembiologischer Ansatz für die Biomasseforschung
R. Lemke, M. Hajirezaei, B.H. Junker, J. Müller, B. Usadel, R. Wünschiers and F. Schreiber
GenomXPress 4/09: 16-18 [download issue]

An algorithmic approach to analyse genetic networks and biological energy production: an introduction and contribution where OR meets biology
Ö. Uğur, S.W. Pickl , G.W. Weber & R. Wünschiers
Optimization 58: 1-22 [abstract]

Nach oben

CLB

Beiträge für die Zeitschrift Chemie in Labor und Biotechnik.


2013

Synthetische Biologie – Forscher wollen Lego
A Mergner, M Wilhelm, T Zoll & R Wünschiers
Chemie in Labor und Biotechnik, 2013, 64: 296-309 [PDF]

2008

Wasserstoff und PDAs: Ein Experiment mit Brennstoffzellen
R. Wünschiers
Chemie in Labor und Biotechnik, 2008, 59: 102-106 [PDF]

2006

Sind wir, was wir aßen?
R. Wünschiers
Chemie in Labor und Biotechnik, 2006, 57: 128-134 [PDF]

Nach oben

Miscellaneous

2003

Brennstoff für die Zukunft: Psion als mobiles Messinstrument
R. Wünschiers
Notebook, Organizer & Handy, 2003, Heft 5: 106 [journal]

1999

Firmenportrait: ALVITO Biotechnologie GmbH
R. Wünschiers & S. Borzner
Laborjournal, 1999, Heft 9: 46 [journal]

Firmenportrait: Trifolio-M GmbH
S. Borzner & R. Wünschiers
Laborjournal, 1999, Heft 3: 32 [journal]

1998

Das Internet
S. Borzner & R. Wünschiers
Lebendige Erde, 1998, Heft 6: 531-534 [journal]

Diese Viren sind anders - Marburger Virologen untersuchen polares Knospen von Masernviren
S. Borzner & R. Wünschiers
Laborjournal, 1998, Heft 9: 20 [journal]

1996

Blue Light Syndrome III
R. Wünschiers
ESP Newsletter, 1996, 87: 7-8 [article]

Nach oben

Talks

Moderne Gentechnik: Ein Biodiversitäts-Killer?
Saxony5-Woche
Mittweida; 22nd of ctober 2019

Wie läuft das mit dem Wasser?
KinderUni, Hochschule Mittweida
Mittweida; 18th of May 2019

Erbschaft – besteht aus mehr als Erbgut und Materiellem
12. Gothaer Seniorenakademie
Gotha; 25th of Frebruary 2019

WYSIWYG could be TGGTACAGCATCTGGTACGGC – or better
2nd Workshop BioInformatics meets Machine Learning
Mittweida; 12th of December 2018

Sollen wir uns gesund mutieren? Über Gentechnik und Menschen
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 15th of November 2018

Kann man Lebewesen bauen?
Lerncamp
Grünheide; 13th of September 2018

Nonlinear Life from a biological point of view
Summer School "Nonlinear Life edition 2"
Riga; 15th of August 2018

Kann Leben fabriziert werden?
Abend der Naturwissenschaften, Julius-Motteler-Gymnasium
Crimmitschau, 07th of June 2018

Egoistische Gene, böse Technik, oder was?
4. Ringvorlesung - Studium Generale
Mittweida; 2nd of May 2018

Umwelt – Dritte Welt – Eine Welt
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 26th of November 2017

From Computational to Synthetic Biology
SynbioDay – Infotag der Synthetischen Biologie
Düsseldorf; 5th of October 2017

Gene, Genome, Genies
LernCamp des gymnasialen Netzwerks zur individuellen Förderung besonders begabter Schülerinnen und Schüler (GIFted)
Auerbach/Germany; 1st of September 2017

Nonlinear Life from an Biological Point of View
Summer School "Nonlinear Life", Riga; 24th of August 2017

Wir müssen reden! Über Züchtung – beim Menschen!
Nacht der Wissenschaften, Hochschule Mittweida
Mittweida; 9th of June 2017

Woher kommt der Strom aus der Steckdose?
KinderUni, Hochschule Mittweida
Mittweida; 5th of May 2017

Kinderwunsch - Wunschkinder. Wie aus Liebe Reproduktion wird.

Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 24th of November 2016

Neue Gene ohne Technik? Über Dinge, die wir tun und lassen können.
Bürgerakademie, Hochschule Mittweida
Mittweida; 5th of October 2016

Alle Menschen sind gleich, oder?
LernCamp des gymnasialen Netzwerks zur individuellen Förderung besonders begabter Schülerinnen und Schüler (GIFted)
Auerbach/Germany; 1st of September 2016

Choice from Noise - Modelling Biology
Integration of Expert Knowledge for Interpretable Models in Biomedical Data Analysis
Dagstuhl; 30th of June 2016

Wie Biotechnologie und die Neandertaler unsere Zukunft präg(t)en
Nacht der Wissenschaften, Hochschule Mittweida
Mittweida; 3rd of June 2016

Forschung in der Fachgruppe Biotechnologie und Chemie - Bericht von der Nachwuchswisenschaftlerkonferenz
Labmeeting, Hochschule Mittweida
Mittweida; 27th of April 2016

Kinder nach Maß - neue Möglichkeiten der Fortpflanzungsmedizin
Prof. Christina Niedermeier (Juristin) und Prof. Röbbe Wünschiers (Biologe)
3. Ringvorlesung - Studium Generale
Mittweida; 27th of April 2016

Transcriptome Analysis Of Hydrogen Producing Rhodobacter Spheroids 2.4.1
Wappler, Nadine; Helbig, Karsten; Weber, Jost; Wünschiers, Röbbe
17. Nachwuchswissenschaftlerkonferenz 2016
Hochschule Schmalkalden/Germany; 20th of April 2016

Grüne Gentechnik: Teufelswerk oder ethisches Gebot?
Eine Podiumsdiskussion veranstaltet von der Kreisvolkshochschule Harz und der Ev. Kirchengemeinde Quedlinburg mit Prof. R. Szibor, Prof. M. Wähner, Prof. R. Wünschiers und Frau S. Höhne (Ev. Akademie Wittenberg)
Quedlinburg/Germany; 13th of February 2016

Warum werden die Blätter im Herbst bunt?
KinderUni, Hochschule Mittweida
Mittweida; 26th of September 2015

Computer gegen Viren
LernCamp des gymnasialen Netzwerks zur individuellen Förderung besonders begabter Schülerinnen und Schüler (GIFted)
Auerbach; 25th of September 2015

Biotechnologie im Lichte von Ebola
Nacht der Wissenschaften, Hochschule Mittweida
Mittweida; 5th of June 2015

Algen machen Spass - und geben Gas
Ehrenkolloquium zum Tod von Professor Horst Senger
Marburg; 4th of March 2015

Biotechnologie im Zeitalter von BigData
Bundesweite Netzwerktagung der biotechnologischen Gymnasien
Mittweida; 3rd of March 2015

Was ist an den Grenzen los? Lebenserzeugung im Labor - Zwischen Leben und Tod?
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 3rd of December 2014

Biotechnologie - Zukunft einer Ingenieurwissenschaft
Tag der Wissenschaften, Berufliches Schulzentrum für Agrarwirtschaft und Ernährung
Dresden; 25th of November 2014

Sanierung und Modernisierung des Menschen.
Tellerrandgespräche, Kirchspiel Quedlinburg
Quedlinburg; 17th of October 2014

Synthetic Biology: Concepts, Values and Politics
Panel Discussion at the ICI (Institute for Cultural Inquiry) Berlin
Berlin; 19th of September 2014

Bakterien aus dem Baukasten – Biotechnologen als Designer
Prof on Tour, Paul-Spiegel-Berufskolleg Dorsten
Dorsten; 8th of September 2014

Moderne Diagnostik: "Muss ich den Doktor sehen, oder kann ich ein paar Haare schicken?"
Nacht der Wissenschaften, Hochschule Mittweida
Mittweida; 13th of June 2014

From light to fuel: Omics research in the field of biomass fermentation and photosynthesis
10th Plant Science Student Conference, IPK Gatersleben
Gatersleben; 2-5th of June 2014

Vom Spickzettel zur implantierten Speichererweiterung - Über die Modernisierung des Menschen
2. Ringvorlesung - Studium Generale
Mittweida; 7th of May 2014

At the Edge of Understanding: Bridging Computational & Experimental Biology
Universitat Politècnica de València, Institute of Mathematics
Valencia; 24th of March 2014

Nach oben

Poster

2017

Biologische Wasserstoffproduktion durch Fruchtsaftfermentation mit Rhodobacter sphaeroides Stamm 2.4.1
N Wappler & R Wünschiers
7. Statuskonferenz "Bioenergie - mehr als eine sichere Reserve?!" des
Förderprogramms "Energetische Biomassenutzung"
Leipzig/Germany November 20-21, 2017

Entwicklung von Methoden für die genombasierte Analyse von Mikroorganismen in Bioaerosolen
R Leidenfrost & R Wünschiers
Expertenforum Bioaerosole - Von der Messung zur Bewertung
Berlin/Germany; September 26-27, 2017

Towards introducing nanopore sequencing to undergraduate ducation in biotechnology and computational biology
R Leidenfrost & R Wünschiers
18. Nachwuchswissenschaftlerkonferenz
Hochschule Mittweida/Germany; 31st of May 2017

2016

Description and application of a pipeline for generating versions of genome-scale metabolic models from sequence information
E Zuchantke, M Siurana, D Fuente, L Lemus, R Wünschiers & JF Urchueguía
XIII Symposium on Bioinformatics
Valencia/Spain, May 10th to 13th 2016

Untersuchung der Dynamik biochemischer Prozesse einer Biogasanlage während des Anfahrens - Eine Metatranskriptomstudie
Stark, Lucy; Wünschiers, Röbbe
17. Nachwuchswissenschaftlerkonferenz 2016
Hochschule Schmalkalden/Germany; 20th of April 2016

Cell-Free Protein Production – The Development Of An In Vitro Expression System For (Cyano)Bacteria
Leidenfrost, Robert; Wünschiers, Röbbe
17. Nachwuchswissenschaftlerkonferenz 2016
Hochschule Schmalkalden/Germany; 20th of April 2016

2015

Untersuchung der Dynamik der biologischen Prozesse in Biogasanlagen
L Stark & R Wünschiers
24. Internationale Wissenschaftliche Konferenz
Mittweida, Germany, November 19th to 20th, 2015

Analyse der Photo-Wasserstoffproduktion eines neuartigen Rhodobacter Stamms
N Wappler & R Wünschiers
24. Internationale Wissenschaftliche Konferenz
Mittweida, Germany, November 19th to 20th, 2015

Proteinproduktion ohne Lebewesen – Entwicklung eines in vitro Expressionssystems für (Cyano)Bakterien
R Leidenfrost & R Wünschiers
24. Internationale Wissenschaftliche Konferenz
Mittweida, Germany, November 19th to 20th, 2015

Forensische Mikrobiologie: Effiziente Klassifikation von Hasenpesterregern
E Zuchantke & R Wünschiers
24. Internationale Wissenschaftliche Konferenz
Mittweida, Germany, November 19th to 20th, 2015

Omic-basiertes Monitoring des Wasserstoffentstehungsprozesses mit Rhodobacter sphaeroides
N Wappler & R Wünschiers
6. Statuskonferenz Bioenergie
Leipzig, Germany, November 11th to 12th, 2015

Solargestützte Erzeugung von Wasserstoff und Biogas
R Wünschiers
Biotechnica 2015
Hannover, Germany, October 6-8, 2015

CanFindIt: An in silico clade identification tool for Francisella tularensis
E Zuchantke, R Wünschiers, M Forsman, H Tomaso
8th International Conference on Tularemia
Opatija, Croatia, September 28th to October 1st, 2015

CyanoDesign – A web‐based tool for the generation and analysis of in silico mutants for Synechocystis sp. PCC 6803
G Kind, A Montagud, E Zuchantke, M Siurana, JA Conejero, P Fernández de Córdoba, R Wünschiers & JF Urchueguía
1st International Solar Fuels Conference
Uppsala, Sweden, April 26 to Mai 1, 2015

Protein Interaction Network Analysis and Visualization of Synechocystis sp. PCC 6803
E Zuchantke, G Kind & R Wünschiers
16. Nachwuchswissenschaftlerkonferenz
Berlin, Germany, April 16, 2015

2014

Analyzing the metatranscriptome of an anaerobic digestion plant during start-up
L Stark & R Wünschiers
Biogas Science / International Conference on Anaerobic Digestion
Vienna, Germany, October 27-30, 2014

Re-Sequencing Rhodobacter sphaeroides strain 2.4.1 to facilitate understanding varying hydrogen evolution rates
N Wappler, E Zuchantke & R Wünschiers
Genomics and Transcriptomics in Geobiotechnology and White Biotechnology
TU Bergakademie Freiberg, Germany, October 26-29, 2014

Transcriptomic Monitoring of Escherichia coli Growth
N Wappler, T Giersch, L Stark & R Wünschiers
Joint Conference of the Association for General and Applied Microbiology (VAAM) and the Society of Hygiene and Microbiology (DGHM)
Dresden, Germany, October 05-08, 2014

A Web-Based Knowledge, Modelling & Visualization Base
G Kind, E Zuchantke & R Wünschiers
Joint Conference of the Association for General and Applied Microbiology (VAAM) and the Society of Hygiene and Microbiology (DGHM)
Dresden, Germany, October 05-08, 2014

Analyzing the metatranscriptome of an anaerobic digestion plant
L Stark & R Wünschiers
Joint Conference of the Association for General and Applied Microbiology (VAAM) and the Society of Hygiene and Microbiology (DGHM)
Dresden, Germany, October 05-08, 2014

CyanoFactoryKB – An open-source web-based software program for constructing model organism databases for Synechocystis sp. PCC 6803
G Kind, A Montagud, M Siurana, VM Nina, E Zuchantke, D Fuente, JA Conejero, J Triana, P Fernández de Córdoba, JF Urchueguia, R Wünschiers
XII Symposium on Bioinformatics
Sevilla, Spain, September 21-24, 2014

CyanoFactory Knowledge WebBase – A Modelling & Visualization Tool
G Kind, E Zuchantke & R Wünschiers
11th Horizons in Molecular Biology
Göttingen, Germany, September 15-18, 2014

Efficiency of RNA extraction from selected bacteria in the context of biogas production and metatranscriptomics
N Wappler, T Giersch, L Stark & R Wünschiers
11th Horizons in Molecular Biology
Göttingen, Germany, September 15-18, 2014

Transcriptomic Monitoring of Escherichia coli Growth
L Stark & R Wünschiers
11th Horizons in Molecular Biology
Göttingen, Germany, September 15-18, 2014

Insight and pitfalls in metatranscriptomics
L Stark & R Wünschiers
2nd International Conference on Biogas Microbiology
Uppsala, Sweden, June 10-12, 2014

Solargestützte Erzeugung von Wasserstoff und Biogas
R Wünschiers
Analytica 2014
Munich, Germany, April 1-4, 2014

Basic research for a better monitoring in anaerobic digestion
L Stark, T Giersch & R Wünschiers
Saxon Biotechnology Symposium 2014
Dresden, Germany, March 19th 2014

CyanoFactory: An Emerging Technology for Solar Fuel: The Knowledge Base
G Kind, E Zuchantke & R Wünschiers
Saxon Biotechnology Symposium 2014
Dresden, Germany, March 19th 2014

2013

Solargestützte Erzeugung von Wasserstoff und Biogas
R Wünschiers
Biotechnica 2013
Hannover, Germany, October 8-11, 2013

Zeitreihenanalyse der Genexpression bei Escherichia coli zur Validierung von RNA-Seq Daten und in Hinblick auf dessen Verwendung als biotechnologisches Chassis
D Labudde, T Villmann & R Wünschiers
1. Gemeinsame wissenschaftliche Konferenz der sächsischen Hochschulen für Angewandte Wissenschaften
Mittweida, Germany, November 7, 2013

Analyzing metatranscriptome sequence data obtained from a set of pooled microorganisms
G Kind, L Stark & R Wünschiers
8th International Meeting on Anaerobic Microbiology (ISAM 8)
Innsbruck, Austria, June 12-15, 2013

2012

Analyse des Metatranskriptoms in Biogasanlagen
L Stark & R Wünschiers
Wissenschaft und Wirtschaft im Dialog
Mittweida, Germany, July 3rd, 2012